EST 863934 is a singleton


Sequence

>863934 (1 EST) Length=639 TCAGTTTCCAAATGTTTTGCGTTCAAAAATAAAAAAAAACACACCTTTCGATGTGTGATGCTAAACGCGATCGAAGTGGC CCAGGCCCAGCATTCTGGTCCAGGATACTGTGTCTTCTGTTAACAGTAACATTGATTTTGCATCAGAGTTTTTTCGGAGC TCTTGTTTTTCTTTCAAGTAATGCTTTACATTTGAACATGTTTCGGAGCTTTTTAGATAGGACATGAAATTCGTGGAAAT TCTCTTTCTGCCAGTTTTAATTGTTCAAAATTAATGAATTGTACGGTGAATTCATTTTTCAGGGTATAAAGACAATGAAC AGGAAACGAGAAATGTTGCACATGAAACAGCTATTTCAGTTGGATAATCATAGTCTCATTGTTTCACCACATTAGAACTA ATCGAATATTTCGACAATTATTTGCTCGATGTATTGGAGTTGGAAAAAGGTTTAAAGATGCAAGCCTCAGTGATCTCAGA ATGTATGCGTATTTTGCTCAACTTGTTGTTTTATTTTTAAGATCATTGTCGTAATTTAAAGATGCAAAGTGTGGCGTCTC TGGAGTTATGGAGCAAACTGAATTTGGGATCGGTCAGGAAAATTTGAAATTGACTTTCATTGCTAAGAACTCATAATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 863934: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8639341845382AA224598SWMFCA1028SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:33:24 on Tue 21 Nov 117.