EST 863937 is a singleton


Sequence

>863937 (1 EST) Length=597 CAAGTTTGAGAAATTATGTACGATCCATCATCCAGTGCTAATATCAGCGAAGCAACAATTGATCATTTTTCGTTAAATTG GACAGTTGATTTTTGCAAATGTCAAATATTTGGAAGTGTTGTTTTATCAGTACGTATCATCAAACCAACTGATAAAATTA TTTTGGATAGTCGATCGTTGGAAATAACAAATATTAAATTGGATAATGAGATTGTCGATTATCATGTGAAAAATGCTGAT ATTTTGGGTGAAAAGATAATAATCAATGTGGGTAAACGGAATGATGGTGACAAATTTAATCTTACTATCATCTACAATAC AGGCGAAAAATGCTCAGCATTGCAATTTTTGAAAGCTGAACAAACTGTAACAAAAACAAAACCTTACTTATTTAGTCAAT GTCAAGCCATTTATGCTCGTTCAATAGTACCATGCATGGATACACCTTCCGTGAAGCAAAGTTACGATGCTGTGGTAGCT GTCCCCAGTGATTTAATATGCCTTATGAATTGCCGTTGCTGTAGGCCAACCGGAAGAAATTGGAAAAATGATGAAATTTT CATTTAAGCCATCCATACAATACCTCCTTACCTCCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 863937: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8639371845385AA224601SWMFCA1031SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:18:25 on Fri 24 Nov 117.