EST 863938 is a singleton


Sequence

>863938 (1 EST) Length=175 CTTCAAAGGACGACTCCATGAAGATGATCACCCACTATTCGTGCCACGAAATGTGGAGACGTTGCATCTTTTTCCGGCAC AACAGATCGATCAAACGTTCCAATTGCAAATGCAAATGCAATGTACTAAGACAAGTGGATCAAAAGCTATTTTTGAATAA ATTTATGAAAATGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 863938: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8639381845386AA224602SWMFCA1032SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 17:43:33 on Mon 20 Nov 117.