EST 863942 is a singleton


Sequence

>863942 (1 EST) Length=629 GTTTTGCAGAAACACTTTTGCTGCAGACAAGAAGGAATTAANAAGAGGTTGGCTTGCAGCGCAAGAATCTAAGTTGAGTG ATCTTGTAAGCAAAGAGCGGCTGCTGCAAGAGGAACCGAGCGTTCCTTTCAGTTACTGGCAGTGAATACATGTTTGGTNC ACGCTGCAGCTGCAATANGAGAGCAGTAGTTAGAACTACTGCAATCACCGTCATCGTGTAGGGTGGTTCTGTCACCTCCG CATTCTTGCTCTTTCTCTATTTCATAGATTTGGTGCGATTTCTAATCCTCCAGAAGTTCTGTTGTTGACAGGGTGGAAAG ACGCAACTGAAATTAGGCAGCAAGCGTGATGAGCGCAAAATGTGTACGAACCCTCATACGCAATTCTTCTTCATTGCTTA ATATTGCTTAGGAATATGGACGAACATTCCCAGTTACTTCCATTCCAAAACTCTCACTCGGGGTTCAATTCCTCATGAAC AAATGTTTACGAATCTTTTTGTTCAAACAGTTGCCCCTATACGAAGTTCTGAAAAATAACAGGGCTCCCTTGTTATTTCC GACAAAGATGCACTTTAATTGTTTCCATCCACGTGGGTCCATGGGCAAAAATTTGGGCAAGAAAATAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 863942: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8639421845390AA224606SWMFCA1037SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 13:24:38 on Wed 22 Nov 117.