EST 863946 is a singleton


Sequence

>863946 (1 EST) Length=459 ATATATTTCANTTCCTTCTTTCTAANGANTGGTGTCATCTGCAAAAGATTTACCTTATGGTGCTGAATATGCTAAAAGTA ATCGTGCTGCTTGTAAGGGTTGTCATGGTTTAATTTCGCANGACTCACTTCGCATGTCTCTCCGGAAACCGAGTCGTTTT TTTGATGGTTTACANGACNACTGGTTTCACTTCACTTGTTTTTGGAAANNAAATAAAGCAAAAGGACATAAACGAAGCCT CTATCCGTGGTCTGGAGCTTCTAAAATGGAATGATCAGGAACGAATTCGTAAAAAAATAAGCGAAAATCAAGCTGGAGTA TCTGATGTAGAGCTCTCTATTATCTGTGAATATGCTATAACTGGTCGCATCAAGTGCGTTAATTGCAAACGAAATATTGA AAANAATACTCTCAGACTTGGGATGAAATCAGCATGGTATCACGTGAACTGTTTTGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 863946: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8639461845394AA224613SWMFCA1041SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 15:30:46 on Fri 24 Nov 117.