EST 863958 is a singleton


Sequence

>863958 (1 EST) Length=603 CTGCACAGAGCAGATTGTTGAGCAGTGTTTTGCATCGTGGTCTTATGTAGTCAGAACAGGAGTTTAAGGCTACGACAACA CTGCTTGATTAGGTAAAAATCGGTCAGAATAGTTGGTAATCCAGCAGATGAATAAGCGGAATAGATTGATGGCTGACAAG TGGATGTTGTTCTGAAAAGTGCTTGGAAGTCCAGCTTGATGTGCTTTCTCGTTGATACCAAAAGAATGTTGCCGTAGATG CTCTGACGATTCTGATAATGGCTGTGAGGATATTTACCAATTGCTGGAACGTCTTCATAAGTATAATTTTCATCTACCGG TGGATTTGGCTGTGCGCCCCTTTCATCAAATGAAGGATGCGTTTTGAAAAATTTTTTTAACTCATGCTGCTTTTTCTATA TCTTTGAAAGATTATGCTTTGATATACCAAATAGAGCGTATTATTTCCTGTCTTTATTTCTCAATTAATTTATACCAAAT CTGGGTTTTATGATCATTCCATTTTAATGTTTCTAATATTGTCTTTCCTCACTTGGCATTATATCCTCATTCCTATGGGT TCTTTTCGCCTTATATTTTTGTTTCATTGGGATTTTGAATTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 863958: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8639581845406AA224625SWMFCA1077SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:1:34 on Fri 24 Nov 117.