EST 863960 is a singleton


Sequence

>863960 (1 EST) Length=677 TTAAAGAAACCTGAAAATTGATAGCCCAGACACAGCAGACAGTAAGAGTGATATGAAGCAACTTGATAATGAAGCCACTA TTTCTTCTAATAGAAGAGATGAGCATGGAGTGTCGTCACATCCTAAACCAAGTAAGAAGCTTGCATGCTATATGAACAAG TCTCATGGTACTAATGAATACCAAAATGTTCCATCTGTGGATAGTGTGTGTTGGCCAGGCCAGATCCCTCCTGTGTCCAC ACCAGTAACTGAACTTTCTCGAGTTTGTTCCCTTGTTGGAATGCCACAACCAGATTTCTCCTTTCTGAGGACAACACAGA CAATGACAGTTTGTCAGGTAAAATTGTCTAATGGCTTATTGGTCCATGGACCACAGTGCCACTCTGAAAGTGAAGCCAAG GGAGAGAGCTGCACTTTTTGCTTTACAGCAACTGGGCTCCTTGGGTGTGAATTTTCCTTTGCCTCCACCAATATTTCCAA ATTATCCTCCTGCTGTACCACCTGGGAACCGTTCCTCCTGTTTTTTCCCAACCTACTGCTAATATAATGCCTTCATCGTC TCATTTCTTTGGCTCAGTGCCATGGAAAACAACAATGCCAGTTGCTGGGGAAAGGCTTTCACCATCCTTCATACCTGGAA CCATGCCCTTGGGTGGGAAGAATGCCAACCGGAATGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 863960: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8639601845408AA224627SWMFCA1079SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:41:28 on Wed 22 Nov 117.