EST 863967 is a singleton


Sequence

>863967 (1 EST) Length=238 CNGGGCTGCAGGAATCGGCACGAGAAATGCTTCCAATCATCGATGTCATTCAGTTCGCCTTTGTCAATCACAGTTAGCTT TAGCGTCTTCATTGATATTATTATTATCATTACCACACTGATTACTTTTACTCTTCTTGCCGGTATGTTTTTTTTTTCCT TTTTCCGTTCCTTTTNCTCCCTTTCTCTCTCTCTCTCTTTCTCAAACTCTTCCTCTCNCCCTTCCATTAATTTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 863967: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8639671845415AA224634SWMFCA1095SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 13:39:56 on Fri 24 Nov 117.