EST 864046 is a singleton


Sequence

>864046 (1 EST) Length=433 ACTAATCGAACTATTTTTCTGAAGGTTCCCTTAGGATAGCTGGAGTACGTAATAAAGTAGTTATATTCACTCNNACAGTT ATATTCCGTCCCTATTTGAATTTTTCTTCGAATTTCTTCATTTATCAAGTATTAAGTTGTTTAAGTTTCGTGTTATTGCA TTTCATTTCAAACAAATAGCACGGATGAAAGGCGACACAAATGTCCAGTTGAAGGATGCAACAAACGATACAAGAATCTG CAAGGAGCACGTTATCATGCGCGTCAAGTACATGGCTATAGTGAGGATAACGGCACCAATAATGCAGTATCGTTTGACTT GACTGCTGTGGTGCCCNGGACAANTTGCGCCACTGATCCGTCCCGGTACACCTAATTAATATGCCAAATTTGCGTTCCCT TACCAATGTTATCCAATGTTCCCAAACCGTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 864046: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8640461845494AA224710SW3ICA2080SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 17:13:34 on Fri 24 Nov 117.