EST 864058 is a singleton


Sequence

>864058 (1 EST) Length=299 ATTTGATGATTTGCTAATCTTTTCTTGTGCTATTGTATATTTTGTTGAGATACCGCAATTCATTCATTCTATCCAAATTT AATCCGTACCAGATGTCATCCTTCTCTAAGTCTTTGTCGTTGTTGTTGTTGTTGTTGTTATCATGATCATTGTTGTCATT GTTGTCGTGATCATCTTTTATCATTAGATGGTTNGTAAATTTTATTTTTAAATCATTGGAAAATTTTATCCTTTTTATGT CATTTCCAAATGGCGCAAGTTGTTGATAATACTGATTAATGAAGAATAAATATAGTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 864058: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8640581845506AA224722SW3ICA2168SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 20:37:28 on Tue 21 Nov 117.