EST 867494 is a singleton


Sequence

>867494 (1 EST) Length=697 ATGGATTTTGATAAACTGAACTGCGAAGTATGTAAAAATCCTCTATAAAGTGATGCAAGGAATAATTTATTTAAAGTAAT ACAATTGCAACTATATTTAATGCTACATGAAAGAGGTCACATCAAAGAAGGCGAATGATAACCTTTAAAGTACCGATGCT TTATCATCGATGATTTCATACTTTTCGTCCATATTTTCATCGCATAATCTGCCATTACTCATCCTTGTTCTCCATTACTA TTTCCTGTCGGGTATTGCTATGGTGGAAGCAATCAGATGTTATTCATGTGCAAATGATTTTATTGTTTGGCACTGGAGAC ATTTCTTTTTGAAACGAAATTATGGTATTACAGCAAGTGACCAGAGCTGTGCTAAATCGGATTATACACCTGAAATAACG CAACTTTGTCCCTCAACCTGTTTCATTATGTATCTGAATGGTACCAACCGGCACAATGGAGTAGTCACTATTCTTGGGAA CCGTTCGCGGTTGTTCTTCGCAGTTCCTAACCAGAGACCAGCACTCGCAAATCGGTCTTGGCCACATTCACGTGTTTCTC AAATCGGCAATTATTTATCATCTGAATTTGATATGTACGACATAGCAAAACATTGGTGTTTCTGTGCACTGAACATGCAT GGGAAAAGTGCTACAGTGCAAATCATATTCTGAATCCCGTCAAACGACTTCGCACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 867494: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8674941849724AA228153SWMFCA1053SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 18:6:29 on Fri 17 Nov 117.