EST 867512 is a singleton


Sequence

>867512 (1 EST) Length=525 TGGGCCTCNTGNANNAGTAGTNAATGGNCACGAGAGACGACANTGTCACCTCACGAGCGGTGACATANTAACCTCCGACT TGGTTGNNGTNNGTACACCTAGGATGTTGTTGTATGTANNCATNGGACATTCATGTNGTNTGTGATATGCCCCGCAGTAC GTATGTNANTNGCTCCGTGGNACTATAGGNTNTAGGTTANTGGAATTTTATNGTATGNTAANATGNAAATATAATCTTGN CTGANTGACGAATAGAATCATGTATGAATGAATNATTGAAATCTTGATGAATNAATGATAAGCACGANGTACNNCAGATT TTATGCATGATGTATGTATGAGTTAACGCATACTGTTCGTACGTCTCCCCGAAATGCTTCTCTCAGCCTTCCCCGACTGA TCCGTCCGGCGGTCCATGCCTGTCCCATTGGGCAAACCCCGGCTGGTCGTGGATCCGCTAACCGGCTCACTGGGGAAACC GCAACTGGCCCAATTTTGNAGCCCCCACGTTGGATGAANGTTGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 867512: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8675121849742AA228184SWMFCA1086SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:18:34 on Mon 20 Nov 117.