EST 867528 is a singleton


Sequence

>867528 (1 EST) Length=627 GTCCAGCATGCTGTTCGCCTGGGCTCTCCTTGCCCTCCTGGGGCTGGCAGCCCCCTGCAGCTTCGTCGTGCCCCGCAGCG AGTGGGAGGCCCTGCCGTCTGAGTGCTCCAAGCCCCTGCAGCAACCAGTCCGCTACGTGGTGATCTCACACACAGCAGGC AGCATCTGCACCAGCCCAGCCTCCTGCGAGCAGCAGGCTCGCAATGTGCAGCATTACCACATGAGCTCGCTGGGCTGGTG CGACGTGGCCTACAACTTCCTCATTGGAGAGGATGGCCATGTCTATGAGGGCCNAGGCTGGAGCATCAAGGGTGACCACA CAGGGCCCACCTGGAACCCCTTATCTATCGGCATCACCTTCATGGGCAACTACATGGATCGGCTACCCCCAAGGCGGGCC CTCCGTGCTGCCCAGAATCTTCTGGAATGTGGGGTGTCTCAAGGCTTCCTGAAATCCAACTATGAGATCAAAGGACACCG GGACTTCATAAAACACTCTCTCCAGGCAACCAGCTCTATGATCTTATCCGAGGCTGGGCACACTACCGCGAATGAGACCT TGAGACCTCCAAAACCACCACCCTGAAATCCTCCTGCCACCTGCTCCTTTCCACCCATCTATCCGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 867528: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8675281849758AA228200SWMFCA1124SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 22:58:59 on Fri 24 Nov 117.