EST 867554 is a singleton


Sequence

>867554 (1 EST) Length=395 CAAAAGTCAGCCTCAGTTGCCATTCCTCAACAACAGTCAGGCTCTCTCATGGACTAGAACTTCTTGACTAGGCTAAGCTA GTGGAACCAGCAGATCTGACTTCTTTTTAAATGTGGGTTCTGGAGGTTGAACTTGGGTCTCTCCATGCTTGTATAACAAG CGTTTTACTGCTGGAACTGTTTCCCCAGCTAGTGTTGTATTTTTGAGTGCTGTTACTGTTATAGCTGTATGTGTAAGCAC TTTGCTTCCTTCCTGTTTGGCTTTTTGAGAACAGACTGGTCTCCTCACCCTGTCCTGAGCTGGGCACCTAGGCATTCCTT TAGATTACTACATGGTGTTTTACTCCGTGAATATAACTTGTATGTCTTTGTTCCTTTGGCTTTTAATTTTTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 867554: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8675541849784AA228174SWMFCA1250SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:29:27 on Sun 19 Nov 117.