EST 867563 is a singleton


Sequence

>867563 (1 EST) Length=582 GACAACGATGACAGCGATGATGGTGATGGTGGCATGCATCCCTACCCGATCCCCTTCACATCACTCTACACCTCGATCGG CAACACCACCGGTCGGTCATATTGCAGTGCTACTATCTTTACCGACCGGTAACAAACACCATCACGAATAGCGCACCTTT CCTCTTCTTTCAACTCTTTTCTTCTTTAATTGGCGCTATTATAGAACTCTGCAAGGCATGCATTGGCATGCATCTTCTGC ACTTCAATGAGCATGCAGATATAATCTAATTGATTCTCTTCTCTTTTCATTGCTTACTTCCATATATAATTTTAGTAATA GCTTTTAATTAGTAGAAATTATAAAGCTATTAAAATTATTAGCTAATTTGTTATATACCATTTCATTCTCAACGTTCTAT TCTCAATTGTACAAAAGTTAATTCTTTTATCTTTTAAATGAAGAAATCTCTGTCCGACAATAATCGAATTGCTTTTTCAT CATTTTCTCTCTTCTTGTCCTGCACTGGAAACCATAGAAACGAATTACCACATTATTTAATTGTTCTCCCCAAATTTTAC ATCCAAATATTAAACTCACCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 867563: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8675631849793AA228222SWMFCA1261SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 17:11:36 on Fri 24 Nov 117.