EST 867575 is a singleton


Sequence

>867575 (1 EST) Length=590 GATTTGGCACAGACATCCTATTTCATGGCTACCAACAGGTTGTTATCCTGACCCTCTTTGTTGCACTGTTGTAGCACACT ATAGCTTCCTTTAATGCAGGGCCCCCTCAACGTGTCTCTTGCCCTTGTTGCAACAGGAGACTGGACCATCTACTGTGGTG GTACCTTCCTGGTTGCTTTGCGGTGTATTGTACAAGGGACTTTGGGCACAGAGGGGTTAAATGCACACTGTGAAGTGTAG TGGTGCTTTCTGGTGGCATATTCTCGATTTGTGAGTGCATAAGTCTAAACTTGGTAGCCTGAATAGCAGCTAAAGATTAC ACAGAGCTAAACTTAACCTAGAAACTTGGTAAGTATAAAGCTATTTCTAGTTTATAATTATAGTTAAATGACTTTATTTT TACATTGATCCAGTCTTTGAAATCATTGCTAAAATTTAAGTTAAATTTATGTTATTTTGGACTTGTCCCAAATAATATTC CAATAAGTAAATTAAAAATTATTAAATAATAACCATGGCTAATTTTGCAGAAATACAATCCTTAATTTAAAAATCCTGCT TTCCCGTTTAAAGTACCAATATATGTGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 867575: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8675751849805AA228234SWMFCA1274SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 2:14:8 on Thu 23 Nov 117.