EST 867582 is a singleton


Sequence

>867582 (1 EST) Length=169 CGGCACGAGCGCCGGAATTATAATTGACGGGTACTATGGAAAATGTGAAACGAAGTATAAAAACAAATGGTATACTGCAG GAGGGAAAATTACTAAATGGTTGGTCAAATTTAACAGATAGCTTTAATGATAATAACGAAAGTGCAAGTAACGTAAAGAA ATTGANGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 867582: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8675821849812AA228241SWMFCA631SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 11:25:6 on Sun 19 Nov 117.