EST 867872 is a singleton


Sequence

>867872 (1 EST) Length=225 GAGCGGTTTAATTACCCAAGTTTGAGATTTTGNATATGTATGCGACAATTATTTAGACGAGACGCACGTACATGCCGTGT TCTACATCTTGTCTCATACGTTGATACGTGAGTGGAGTGACGAGTCAAGTACGCCAAGTAGCAATGTACCGACCGAAGAT TCGAATACGAAAGAAGTCACGCGTCCATTGCGAGCTTATGTTAGACTATAGCAGTTGCAACTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 867872: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8678721850637AA228531KJ4SLB297T3JHU93SL-BmL4 (JHU)


Date: 9:33:42 on Thu 23 Nov 117.