EST 867876 is a singleton


Sequence

>867876 (1 EST) Length=219 ANTTTTAATTGACCCAAGTTTGAGAAAAAAAATATATGCATATTTATCTCCTCTATTCTACAAAAGTCTAATGGTATCAT AATTATTTCTTGTTCCACGCATTTTTGGGGTCCTGGTTGCTAACTGGGGCATCCCAATTCCGCGATCGGAGATTTAAAGA AGAATCCATTNNAGTCATCACGTCGTCTTCACTTCACTGCGATTGATCGTATCTACTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 867876: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8678761850641AA228535KJ4SLB308T3JHU93SL-BmL4 (JHU)


Date: 4:39:5 on Sat 25 Nov 117.