EST 867879 is a singleton


Sequence

>867879 (1 EST) Length=219 TTTAATTACCCAAGTTTGAGGCACACTATGGGTTTAGTTGATAAACCTATAATTGTTGATGGGAAAGTATCATCTATTGG GACGGTTGGCATCAGTTGTTGCCTTTCAGCTTCTCCTTGGTCAGAAAATTGTTATNCGGATCGGAGATATCGATTCGTAT TCATCGTCACTAGTTTAGCTTCGTGCAGTCGCATGNGCTTCGTGCACATCAGGCAAGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 867879: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8678791850644AA228538KJ4SLB320T3JHU93SL-BmL4 (JHU)


Date: 14:16:17 on Fri 17 Nov 117.