EST 867907 is a singleton


Sequence

>867907 (1 EST) Length=244 TGATGAAGTGGAGATCGAAGGTGGAGAGTCGAAGAGTTTGACTATNACGAGTGCTGCTNCCANATTGTATGTGTTTAGTC CGATGCCGTGTGGTGATCGGAAGAAGTTCGAGGAATGTTAGAGCTGGTGAGATGTGCAGCTGTCTAGTGTCGCTGATGTC GGTATCTGACGCTTCTATTGACTACTCGTCTGACGAGATCGCTAGTATGTGATGCTCTAGCGATGTCGTGATGACTAGTC GATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 867907: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8679071850672AA228565KJ4SLB438T3JHU93SL-BmL4 (JHU)


Date: 16:40:7 on Sat 18 Nov 117.