EST 867915 is a singleton


Sequence

>867915 (1 EST) Length=601 TGGGAAGAGTATACAAATGATGAGCATTTCCATCTGGTCGTTGGACGCATTCCTCAACTGAAAATTCTAAATGGATCAGT TATATCGGCTGAGTTGCGAGAACAATCCGAAAGATTCCTCATAAGGTATTATGATGTCCATGAAACTAAACCGAAAATAT TTGCTAGATTAATTGAGCGGCATGGACATGTGGAACAGCTTTGTAAAGTTGATATGACTCCGAAAAAATATGCTGTTGTT GCCGTAATATGTGAGGAAACTGGATACAATGCAAATCTGAAGATACGCTTAACGCAAACAGTCTCTTGTCTGATGCATAT GCTTGAAAAATTAACAAGAATTCCTGTGAGACGTATGCGCCTGTTTTACATTAACAGTGGTAATCCATTCCCGGATGAGT TGCGTTTCCCAAGTCAAATGCTTCAAGCGTTGCATATCGAAGATGGTGGTAAAATCTGTGTCCAGTCGAAAATGGTGATT AGTAGAAAGGAATGTATTGCAAAGTGATGCTTTTATACAACGGGAACTCGGGTTGTGCTGCTTGTTTCTTTTCTACTAAC TCGCTTTGTACAATTACTTTGTAATATATATAACTGATCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 867915: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8679151850680AA228580SWMFCA1002SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 8:26:18 on Fri 24 Nov 117.