EST 867918 is a singleton


Sequence

>867918 (1 EST) Length=631 CAAGTTTGAGATGTTAAAAGCAGAAGATCTAGAACAGCAGCAACCAGAAGAAAAGAACTAGCAGCAATTGTCGAAACGAC AACTGTGGAAAATATAGCAACGAATGATCGCGGCGAACCACAGTCACCCCCTTCATATTCATTACCAGCACCATCCAGCC CGAAACATCACCAGCAGAAACGATGTTTGAAATTTGATATGTCTAGTAAAATACAAATAATTTCGAACAACCGTCAAGGA CAACTCAATACAGCATTCCTTGCTACCGTTCCGGGCGTCTTAAAAATTGCCGAAATTGTTTTATCGTTTATGTCATTCAT ATTGGCAATTTGTGCAGACCGTAGTGCTACGACTGCAGCTTGGACTGAGAATATCTCATTCTCAGTTACAGTCATCATTT CTGGACTGCTAATCGGTTATGTCTGTTTCCCACATTTGACAATCAAGGATGAACTGACCAGAGAAGGACTTATCATCGCG GAGCTTATATTCTACGGTACCTCAGCACTATTATTCTTCATAGCAATATGGCTTATGGTNCATCTTTCGGCAGGTTCGAT AACTTATGGACGTGGTTCTGCTATCATGGAGCCATAATATGTGTTGCACTGACAATACTCTTCGGTATTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 867918: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8679181850683AA228583SWMFCA1277SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 21:37:54 on Fri 24 Nov 117.