EST 867926 is a singleton


Sequence

>867926 (1 EST) Length=637 CAGTTGTTTATTTATCACGAAACACACAACGATCTTTTCACACACTTCAAATACGATGAATTTAAGAGCGTCTAACAAAT AAATAAAGTATTAGCTGGGTTAATCTCTAAAAGTCCACGAAAAACGACAAAATTCGATGTGATCTTGAATAGGCATCGAG AAAAAGATCGGAATAACCACAAACCGAATTAGCCCGAAAACAACAATTCAGGACTGATGGAGTATGGTTGTCCGTTACTG GAGAAAATCAGTCCTTATCTCTGTAATCGTATTTTCATTTCTTTTTTCACTCTATTATTTACCATCCAGTGACGACAGCT TCTTCAGATCCGGACGATTATTTCAAAGTGATAGAAGTCGTTTTTTGGCTCAAGTCCGGCAGCAGAGATTTGAATTAGAG GAACGTCAGTTCGATGAGGAACCGAGGAAGGTGGAAGATGAATCTGACGCCATATCTGTTGAGCGTTGTCAATTCATAAT TAATATGACCAAATTTGCTTGGGAGAATTATCGGAAATATGCATGGGGTTTCAACGAATTAAAACCTTTATCACGCTCTG AGCCTAGTGCATCAGTATTTGGTAACGGAAAACTGGGTGCAACCATTGTGGATGCCCTTGATACTTTGTATATTATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 867926: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8679261850691AA228591SWMFCA1286SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 20:57:6 on Thu 18 Jan 118.