EST 867929 is a singleton


Sequence

>867929 (1 EST) Length=495 AGAATTCCTTCTAAAATACCTGCGCTTCCTAAGACGAGTCTTTCTGATTTATCGCAAATGCGACTTGACACAAATATATC ACAAAGACTTCCTTTTTCTGTCTTACCAGTAACTTCTTCTTCACAAACAAATGCATTAGGCTTTGGGACGTACCAAAGAG GAGTTAGTTACTATACACATTTTGGGGGACAACCTCAAGTTTACCTTATCAGTGGATTAAATCAGTGTGTCGTGTCTTCA GCGAATCAAAATACACCAATACTGCCATCAGCAAGTTCTAACCTTGCGCAGGATGCGGTTTTACGACCACTACGAACTGC TACAGCACTTGAAGGAAGGACTTGTCAAATTGGAATGAATGATAAAGTTTATATATCAGGGCAGTATTCAATCGCACCAC CAGTTAATAATGCACCCATTAACTGATGTGTTGCAAAGAGACAATCTCTCCAATTCCTATATTTGAAGCGAAATCTTTTC AACGAATACAATGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 867929: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8679291850694AA228594SWMFCA1290SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 15:55:37 on Tue 21 Nov 117.