EST 867936 is a singleton


Sequence

>867936 (1 EST) Length=642 TGTGATATACGTTCCAGGGCATTGGAAACTTTTTTCTAGAAAGTGTATTGCCGGTGATGATTATATTGAAGGACGGTACC ATCACGGCATGAATAAGTGAAATGGACGTGGGTACAACCATAACTTCAAGAACACCTTCTAGGAAAGTGAATGATTGCCA TGAAATTGTCAAGTCCTCAGCTGTAGCTGGAGAAAGAAGGGGGAATTTATGTTCTGTACATCAAAGTGGTGTGAGGAAAG CCAAAATTAATGTTGCATGTCAGACCGATCCCGATGAGGAAACATTCCCGAAAATCACGCAGTGTTCTCGGACCACTATT TCCCAACCTGTTGCAAATAAAGGTACCGTAGCGTCATCAAGTACTGATGCTAGCTCTCCTACATCAAGCACTTCATCTGA TGGGACATTGCGATTGATGATTCAAAACTTCACCAACATGGCTGATACTGTGAGGGGGCCAAGTAAAAAGATACAAGCTG TTCCTTGGCGAATAATGGTGATGCCTCCACAGCATGTTGTACAAAAGAAAGGCACGCAAAAGTGTTTGGGATTTTTTCTG CAGTGTTGTCCAGATGCTATTCTGATTCATGGTCGTGCCAAGCTGCGGCAGAATTGCGACTAATTTCACAGAAGCAAGGT GT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 867936: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8679361850701AA228578SWMFCA879SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:36:30 on Sun 19 Nov 117.