EST 867979 is a singleton


Sequence

>867979 (1 EST) Length=314 AGCAATATTAATTAGAAAGTATTGCATACATACCATTTCATCCTTTCAAACCATTGATTTTAAAAGGAAAAAGTTTATGA AGGCCGTTGGAATTAGATGGGAGAATTAGTACAACTTGAAATTGGAAGCATTGTGGAAGGATGGAAGATTGATGGGAAAC TTGGAGAAGGTGCTTTTGGTGCTGTATCGTTTGTTCCAAGGATAACAAAAAATATGCACTTAAGGTAGAAAGTGTCCATG AAAAAGTTGGCTTCTTGAAAATGGAGCTAACAATGCTGAGTAAATTGAAGAGCAAGATCGCCTACGACATTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 867979: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8679791850744AA228638RRAMCA421SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 15:8:6 on Wed 22 Nov 117.