EST 867992 is a singleton


Sequence

>867992 (1 EST) Length=208 AGGTGGTACGTAGGTAGTATGTTAAGGATGAAGAACAAGAAGAAGCTTCATCGTTATGCTAAAGCTGGTCATCGATTTTG TCAACCAAACGTGGATAATGATACATCCATTCAGAGTGAATCAGGGAAAATATGATGGTGTANAAATAGTTGGAAAAAAG TGCTGATGAAATTGAATGAAAGAAAATAGCTGCCTAAAAATTGAATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 867992: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8679921850757AA228651SW3ICA2061SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 2:33:48 on Fri 24 Nov 117.