EST 867994 is a singleton


Sequence

>867994 (1 EST) Length=380 TTGAGACATAGTGCATTGTTCTCAAATAGAGCTAAGGCTTGATAGCGACGTGCACTTACTAAAGAGGAGAAATGGCAAAC CAAGAATTAGCATGCGTCTATGCAGCACTTATTTTGCAAGATGATGATGTTGCAATCACTGGTGATAAAATTTCAACCAT CTTGAAAGGCTGCACATGTTGATGTTGGAAACCAATTCTGGCCCAGGGAATTAATTTGCCTAAAGGGCCTTTGGGAAAGG GAAGTTTTGAATGGTTGAAAGTTCCCTTTNGAATAAACCTTAAACCAATTTAAGTTTTCCAAAGGTTNGTTTTGGGGTTA ANTTTGGGTTGGGGTTTGGGNTTGNCCTTGGCCAAGCCCAAGGGGAAATTTTANCCCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 867994: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8679941850759AA228653SW3ICA2063SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 11:58:18 on Wed 22 Nov 117.