EST 871305 is a singleton


Sequence

>871305 (1 EST) Length=600 CTATAACGAACTTAATAGAATTTCTTATAATTTTGCTGAATAATTTCTACTTTTGGTTTTTATTTCTCATTTTTATTATT TTTTTGTTTTACATAATTATCGATTATTTTTCGCAGACTTAGTCTACAGAACGCATGTTAAAGGCGCTTATTCAGTAACC AAAGCGGCTTGGTTTTTTTTCAAAAAACAGGGGTATGGACGAATTATTTTCATATCTTCAAATTCTGCAATATACGGCAA TTTTGGACAGGCAAATTATGCAGCAGCTAAGAACGCATTAATTGGTCTTTCGCACACACTAGCAATTGAAGGAAATAGAT ACGGCATTCATTCGAACGTGGTGATACCTACCGCATCGTCAAGGCTGACAGAACAATTATTTCTTGAAGAAAGTTTGCGT TCTCTGAAAGCAGAATATGTTAGTACCACTTGTTATATATCTTGGGACATGAATCTTGTCAAGAAACTGGAAAAGTTCTT GAAGCTGGTGCTGGTTGGTTTGGACAAATTCCAGCCTATCGTTCCAAAAGGAATGGTCTTGCCGGCTGCAAATGCGGAAA CTATTGCCGATAACTGGACGCAATACTGACATGACTCAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 871305: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713051854961AA231998SWMFCA1301SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 13:35:18 on Fri 24 Nov 117.