EST 871309 is a singleton


Sequence

>871309 (1 EST) Length=630 GTCAACCTCAAACCACAAGACACTTCCTGCTCCGAAGCTTTTTAACTGCTTTTGAGACCTCACATTGAAGATGGCTCAGG CAACAACAGTCGACTGATCTCGAAGCATTTTCGTAAAGCTGAAGACGGTAAATGGCCAACATATTTGTTCGATTTTAAGG CTCGAAATAATGATAGTTTGGGGAAGGGTGATGTCATGGATATGGTACTGCTGGCCCTGAAGCAATTGGCACCGGGCAGT CATGTTTCGCTGGATAACCCACATATTGTCATATTAGTACAAATTGTGCACAAATCCGTAATGCTCTCATGTGTCAAGCA CTTTCTGGCACGAAGAAAGCTCAGCTTACATCACAAGGGAATAAATGGACGTGCGGTAATGGGCAACAGTAAAGATAATT TGTGTGTGTTATACTTGTTTTAGCGATACTTTGCTGATATTGTGATACTACGGTAAGCTACATGCTATAGATAGGCTTTT CTTTGGGTTCATGTATTTGTCCATTGAATTTTAAGAGTCATATGCTTTGTTGTATGAAAGGTTTGGATGATAGGGCGGTT TGTATTAAATCAAAAGTCATAAAAAAAAAAAAAAAAAACCAAGGGGGGGCCGGGTCCCAATCCCCCCTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 871309: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713091854965AA232002SWMFCA1309SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 7:27:25 on Sun 19 Nov 117.