EST 871310 is a singleton


Sequence

>871310 (1 EST) Length=473 AGATTTATCTGAGTGCTTCAGATCAGACAGAAAAAGGAATGTATAAGTCCTAACTATCTATCACTTGTTTGTTTGAAAAC TTTCTTTGCAATTGTTAAGGATGATGGTCTTCTCATGTTTCTGTAAAAATCTAACTTTTTAGAATATTAGCTACTTAACG CTTGTATTTCATATCTGTAGTATAGATGTTAGTTTCTAATTATCCAAAAACTTTTTACTTTCACTTACCTCTACGGTCAC TGTGATCCTCAGTCACTGTGTTACAGTTTTCTTTTTATTTATTATTGCAAAATAATTTGTAAAATATATAATTCATTTGC TTTACTGGTTTTCTTCGCTCCTTTCACTTTTAACTTTTCACGTTTTCATTGAAAATTAAAATCCTTGTACCTGTTGGCCT GCAAATTTAAAAAGCATCCCAACGGGTAATTCCCTGCCGAATAGAATAGACTTACCCCCCGTTTTCCTCCGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 871310: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713101854966AA232003SWMFCA1310SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 7:14:52 on Sun 19 Nov 117.