EST 871314 is a singleton


Sequence

>871314 (1 EST) Length=654 CAAGTTTGAGATCACTCAACTTCAAATGGTTATACTCAACTTTAATGTTGGCGGACGGCAGTATTCCACAACAGCAAGCA CACTAATGCAAGAAAAACAGTCTCTATTTAATCAGGTTAGTTTTATTTCCACTAAATTTCTTTCCTTTTATTTAAATTAT CGGACATTTGTCCTCTAAAACTGTAATGTGACGTGACTGTAAATCAACCTACTTTCTTAGTTCACAATAACCATTGTCAC CTTGTCATGTCGTGGTTTTAAGATTTCAAAGAATCAAATGTAAATAAAATTTTTTAATTAGTGGTTTACTGGAGAAACTG CACAACCGCCGTTAGAAAAAGACAGCAAAGGAGCATATTTTATCGATCGAGACCCAACGAGTTTTGGAATAATCTTGAAT TATCTGCGTTTGAAATCTACTAAACAGCTATGGGAAGCTTGCTTACCGAAAGATCCAGATCGTTTAGCTCTACTAACACA GGAAGCTGAATATTACAAGTTTGTGTTAAATCACAGAGCCTACAAATGCTACTTCTTGACCAAAATATTATATCTATCCC AGTTAGAAAGGAAGCTGTAAAAACCTCAATTACCGTCTAACACCTTTAACATATAGCTTATACCAAACATCAACAACATT TCTACTCTCCTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 871314: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713141854970AA232007SWMFCA1318SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:29:21 on Mon 20 Nov 117.