EST 871324 is a singleton


Sequence

>871324 (1 EST) Length=651 TATATGTATACTACAATATCTTCAGTAATCGTTCTCGTTATTGCACTCTTCATCGTTTGTTCTTCGCAATTTATTTTGAG CGAATGTCTAAAAAATAAGGCTTGCATATTTATTTCGGCAAATTGTGAGGAGAAAAGAGATTGTGAAAAAATTATTAGTT ATGCATTAGAACCAGATGGTTGGGTAGTTGTGGAACTGTTTTACAATACGACACATCCGGACACTAATTATGCAGCAATT GGCTTCTCTAAAGACACTCAGATGGGAGACGAAGGTGTAACGCACTGTGGACTCGGTGAAATGAATCAAGCGGGAGTATT TCTGTCTCAGAATGACGGCAAACGTAACATACCGCTGAATTTAACAGCAGAAAATGCCGCAAAGTACGTGGAGTTGTTAG AAGCCAGTCATACATCTAGTTCAATTTACTGTAAATTTCGACAAAAGGTTGCGCCAGATGAAACAGCTCAAAAAGCTCGT GTACCAGATTTGAACCGTACTTATTATTTGCTTTTAGCATATGGCAAGACTAACAAATATGAAGAATTGGATATACATTC ACTGGATGAACGTCCAAGGATTTTCCGCTCTTATTTCCACACCAGTTAATATTGCTGAACGGGAAAAACAACATTGGCGC CGGTTAACCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 871324: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713241854980AA232017SWMFCA1328SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:57:28 on Sun 19 Nov 117.