EST 871330 is a singleton


Sequence

>871330 (1 EST) Length=654 AAGGATGATAACGAAGATTAAATGATTCCAACTACGATGAGTTTGAAGGTTACGGTGGGAGCTTATTCTCGAAAGACCTT ATGATAAAGATGACGAAGAAGCAGACGAAATTTACAGTGCTGTTGATTCTCGGATTGATGAACGTCGGAAAGAATATNGA GAGAAGAAATACCAAGAAGCTATTGAAAAATATCGTAAAGAACGGCCAAAAATTCNGCAAGAGTTTTCTGATCTGAAGCG TCAATTGTCCANCGTAACGGAAGCAGAATGGTCGGCNATTCCAGAAGTTGGTGATATTCGGAATNAAGCGAAACGTNATC CACGAGCAGACAAAATTACTCCAGTGCCAGATTCAATAATCGCATCTGGCTATGTCCTATGGCCCGATGAATAGCCAGAT GGGACAGTCGTATTTCAGTTCAGGTCTCTTAACACCTATGGGTTCCGGGGATTACTTCAACGTTTATTGGAATGACTTCC TACCTATGGTAGTGGTTTTATGTCTACACCTAAGCCGGCATTAAAAAATTGGTTTGGTTAACCCCAGGGATGGGAAAATC CGGGAATTCAATCCGGCTCTTTCATCATCCTGGCGGGATCTTTGAATTTTACGAAACAAAATTGGGCCCGGGCTCGGGAA CCCCCATTTATGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 871330: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713301854986AA232023SWMFCA1334SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 10:32:36 on Sat 18 Nov 117.