EST 871334 is a singleton


Sequence

>871334 (1 EST) Length=488 CTCAGTCGTGATTACCCGCTGAATTTAAGCATATAACTAAGCGGAGGAAAAGAAACTAACGAGGATTTCCCTAGTAACGG CGAGTGAAAAGGAAAAAGCCCAACGCTGAATCCAATAGACATTATATGGCTATATGGAAATGTAGCGTATAGGTATAACT ATCCGTAACATATTTTTACACCCAAAGTCCCCTTGAGCGGGGCTACAGTCCATAGAAGGTGCTAGACCTGTACGGGTGAA AAAAGTTACGGTAGGTTATTCCTTGGAGTCGGGTTGTTTGAGATTGCAGCCCAAAGAGGGTGGTAAACCTCATCTAAGGC TAAATACGACCATGAGACCGATAGCAAACAAGTATCCTCAGATTGGTTAGAAGAGCAAATTATGGGCTTCGATGATTTAG TGCAATCGGTTGACATTGTAGCTTTCAATAAAGTATAAGTAATGACGGATGTTTTATTGTTGATGTTGTTGGAGAATAAA TATTTCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 871334: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713341854990AA232027SWMFCA1343SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:33:49 on Wed 22 Nov 117.