EST 871337 is a singleton


Sequence

>871337 (1 EST) Length=650 GAATCGGCTCCCTCCAGGACANATCAGGCACCGTAGGCCTCAATCCCTGAGACTCTGGGTTTCTTTCCTCTTGGCCCTGT CACCCTTCAATGGTGTGACCGCTGCTGTGAGCCAGCTCCAACGTCCCAGGTACTGAAAGACGAGGGAACTTTGTCCTTTG GGGCAGCCGGCTGGAGCATCATCTTCTATCTTCCTGCTGTCAGCAGCTATCACTGTGTGGCCCAGCTTGTCTTGGGGGCA GTGGTACCCTAGTCCCTAGTGTGAGGGACAGGGAAGACAGGCCTGGGGCTCAAGCCCATCTCCTGGAAGACAGTGTTATT TCCTTGGCTTCAGCCTCCCACACCGTGGTGTCAGGACTGCCGTGGTTAATGTGTCCTGAATACTTAAGAGAGCTACACAG AATGAGGCCTTGCCAAAGAGTAGGGTAACGACCTTCCAAGGGTGGTTAACCCAGAGATCAGGATAGAAATTGTCCAGGAG CAAAGGACCCTACTCTGGGCCAGCTGAGTAGGCCTTCACTTCCAGGCAACACTCTGGATGGGATGGATGGGAGCAGGTCT TGGAAGAACCTCACAACTGTGGAAGAAGGAACTACACAGTTTAAGCCCTGAAGCCCCAAGACTGGCTCTGGTTTAGAAAG CCCAAACACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 871337: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713371854993AA232030SWMFCA1346SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 2:8:16 on Wed 22 Nov 117.