EST 871340 is a singleton


Sequence

>871340 (1 EST) Length=652 GGAAAATCGAAATTTTGGAAACAGGGACCAATAATCCGAAACGGATTACGAAGTGGGTGCAGGATGTTAGTTCACCATCT CAAAGTGGAACCCCAGTGAAAATTTCTTCGCCACACCAATTCAGTCCTTTCTCTTCAAATCCAAAGGAATTTAAAGAAAA GCAAAAAGCAATAAAAGAAAATCGTCGATTGGGAACAACTTCAGCAGGTCCACAATCGCAAATTTTGGACGGAGTTACAT ATGAAGAGATTGCGCAAATACGGGCGGATGCAGAAACCAGTGATATGGGTCAGGCGGATCGCGTAGTTATGATCGGTACT GCTAGCAAAGGTATAATTGATCGGCAACATCAACACAATGCTCAAGTTTATCGGCAGCTTTACGCACCGAATCCATTCGC AAGTGAAACGGATGAAGATATTCAAAAGTATATGAAGGAATTGAAGCAAAAACTCCAAGACCAAGTTCTGCTGCCGATAG TACTGAACATACGACATCAAGCCCACCTTTATATGAAAACGATAGTCCTTCCGTCGAAACAATATCCTTGATGCAAGCAG CTCGAGAACACCGTACACGTCCCACATTTAATGGTATGGCTCCGCTTCCATTGATGAAGAAGATGATGGTGATGTGACTG AAGAGATATGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 871340: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713401854996AA232033SWMFCA1349SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:18:38 on Thu 23 Nov 117.