EST 871356 is a singleton


Sequence

>871356 (1 EST) Length=615 AATGTAACCGGTGGATCGAAGAAAAGTGTCCGCAACAAAACTAACATCTGCTTCGCCAATTAAATCGAAATCAGATGATG TATTGCCACCATTCACCACAGAAGAAAAGAATATATTGGAAAAAAATATCTTAGGGAGAATTGCTGTTGATGTCCATGAA CTGCAATTCATACCCGCTATATCCGAATCGATTTCAAAAGAAAATGGATTAGATAAAACTGGAACAAACACACCAACAGA TAAGAGTTCACTCGTTAGCGACTGTGCAACTGAATCACTGACGCTTTTAAAATCAGCTCAGTTTATTCATAAGTTCCACA GCAATTTTCCTTCTAAATCACCTAGATCACATTCGCCATTAAAATCGCCAGTCAGTGCTGCAGGTCACATCGCTTTATCT GGAACTGAACAACTGTTTGCGCAGCATTCAAGAACTGCATCTTCTGTTTCCCTACGAAGAACGATCACCCCGAAAGTGAG GAAAAAATTTACCGGGCAGTGAACCTTAGATCCCCAACAATGACTTTGCAGATTTAATTTCCTGGAATCCGAACAACAAA AGAAGGTCCTGAAAATCTCCAAAGAAAAAAAAAACGTGTTCCGATTGGGAATCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 871356: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713561855012AA231971SWMFCA1366SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 2:43:19 on Mon 20 Nov 117.