EST 871382 is a singleton


Sequence

>871382 (1 EST) Length=489 CATCCTCCCGGCCCTGATAATATTGTGATTAATTCTTACATTTCATCTGAGCAACAAACTAGAAATATCCCTATTTCTGA ATCTGCTCTTGGATTTTCTGGTATTAGCTCAGATTCTATACACCCAGCAACCTGCTCATATCCAAGACGACCTTTAAATA ACCAACCACAAAGTGCTCGTCATTATCCTATGAATCCGAGACATAATTACCAAACACCACCAACAGCACATCCTCATTTT CAACATTCTAATTCAAATCGTATGAAGTTGAATAATGATCCATTACACTCCGGTCGGCGTCATTCAAATAGAGATGATGA TCGAGATATTTATTCAATGCTTGGTGTTTGAATAAACATTAGTATCTTTTTAGTTTTTGCTTTTAGCTTGTTAAATTGAT CCCTTTGTTGAACTTTACTTATAAATACTTAGATTGATTCATTATAAATGAATAAAAATTTATATTTTATTCTGGATGTT CAAGATCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 871382: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713821855037AA232038SMIPADA000043M13RSchistosoma mansoni adult worm Lambda ZAP II library


Date: 20:45:39 on Sun 19 Nov 117.