EST 873311 is a singleton


Sequence

>873311 (1 EST) Length=478 GTGTGCTCTTACAGTGGTTTTAAAGTTTATCCGGGACATGGAAAACGCGCTATCCGTATCGATGGTCGTGGGTTTTACTT CATAAACAAAAAATGTGAACGGTCTCATTTCTTAAAGCGTAATCCGCGTGAAATCAGCTGGACGGTGCTCTACCGAAGAG AGTACAAAAAAGGGATAAGTGAAGAGCTGGTAAAAAAGCGAACTAAACGTGTACCCAAGAGTGCTCGAGGTATTGCAGGA GCAAGTCTGGCTGAAATCATGGCTAAACGCAATCAAAAGCCAGAAGTTCGTAAAGCGATGCGTGACCAAGCCATACGTGC AGCTAAAGAAAACAAAGCAAAAGAATGGAGAAAAGGTGAGAGGTCGAAAGAAAAGCCCAGTAGCTCTTCAAACAAAAGCT ACAAGATTACTCAAGGCTGCTCTAGAGTGGTGGAAGCGTAATACTATGTGACATGCTATTTGTGGATAATTTTCTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 873311: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8733111858023AA233971SMIPADA000044M13RSchistosoma mansoni adult worm Lambda ZAP II library


Date: 11:50:38 on Thu 23 Nov 117.