EST 873319 is a singleton


Sequence

>873319 (1 EST) Length=358 GATCTTCATTTTTTCGCAGTCAAACTGTCTCGAATTCTCCATCGAAATTCACTGTGTTGATCTTTGCCTCAGTAGTTTTT ATACATGTATCTCTGCTCGTCTGGTTTTCAACATTAAATCCGTTGTGAATTAAATCAGTACTGTTGGATAATTACATTTG CGATATTTTTCTTATAAATAGACAGTTTGTTGTTTATTTTGCGTCCCACTTTATTTACAAGCTCTGTAAAAGCATTTGAT CCACATAAAACTATGCTTTCCGTGTATACGTGAAACATTGTTTTCAGTTATCGCTTTTCATATCTGCCCGTCTACTTATA TTGCATCACGTACAGATTGTGGGGACTTTCCGTCTCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 873319: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8733191858031AA233979SMIPADA000052M13RSchistosoma mansoni adult worm Lambda ZAP II library


Date: 23:14:10 on Mon 20 Nov 117.