EST 873320 is a singleton


Sequence

>873320 (1 EST) Length=344 GTTTGATTGAAGAAGCCGAAAATACCAAAGTGGATTCGATGGAAGGCGAAGTGATGATGGTCGATACATTGAATTAGATT TACTAATACCTTCCGGTGCAAACGACGAACCATTGGAAATTCCAGTCAATTTTTCAGACTCATCAACTGAGGATGAAGAT TCATCTTCAGAATCGGAAAGCGAATTTCGTGAAATAATCATACCATCTCCAGTTAGACTTAGTTCAGCAGTTTCACCTCT TTGTACATCTCGCAAACTTATTGAAGAACTAAAATCTGTTTGTACTGATGATTGTATAATATAAGATCACTTGTTAAAAA AAAAAAAAAAAACCCGGGGGGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 873320: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8733201858032AA233980SMIPADA000053M13RSchistosoma mansoni adult worm Lambda ZAP II library


Date: 22:52:31 on Wed 22 Nov 117.