EST 873321 is a singleton


Sequence

>873321 (1 EST) Length=247 AAAATCTCAAATATACACCGATTTTTGGATTTTACCTTTCCCAGGACTCTTGCATATTTGTTGACCGAGGTAATTTTGAC GCAAAAGCCGCTATCAGCACACTAAATAGATATTAAACAACTTCAGTCTAACACTTGGATGGTTATTTACCCTGTATAGG GTACGAGTATATAATCCATGGTAAGCACGATGTGATTGACGCTTCGCAAAAATTTGCCGTTGAAAAGGCTGGTATTAAAC CGTTCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 873321: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8733211858033AA233981SMIPADA000054M13RSchistosoma mansoni adult worm Lambda ZAP II library


Date: 21:23:7 on Sun 19 Nov 117.