EST 873324 is a singleton


Sequence

>873324 (1 EST) Length=248 TTGTTTGTGCATTAAGATTACTACTACTGATGTTATTATTACAACTTCTGTTCGGCGCTCCACTTTCATACTGCTGCACA AACAAATGAAACACTTGCATCGTATAACTCACCTAATAATAGTAGAGACCGCAGAAATCTATGTGTTACGCTAATAATAC AGTCATCATTCAACTCCTCAATTGTCTAGTATTGATATGCTAGTATGGACTACTAGTATAGGTGATGCTAGTGGTATTGA AGATTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 873324: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8733241858036AA233984SMIPADA000057M13RSchistosoma mansoni adult worm Lambda ZAP II library


Date: 0:40:18 on Sat 25 Nov 117.