EST 873327 is a singleton


Sequence

>873327 (1 EST) Length=200 CTCGTGCGCTCGTGCCGAATAGTCAATAATTATAATGATTCAAATAAATATACATCAAAAGAATCTATTAATCAATTACA TATGAATGATTATCATACAGCAAGATTTGAAAAACGTGCTCAATCTATTTTACATACATTAACTAGTTCACAATCAATTA TATCATCAGGTATACAGAAAGAAAAAAGAAAAAATAAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 873327: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8733271858039AA233969SMIPADA000060M13RSchistosoma mansoni adult worm Lambda ZAP II library


Date: 22:3:43 on Fri 17 Nov 117.