EST 873329 is a singleton


Sequence

>873329 (1 EST) Length=202 GGAATAAAGACAATTTAGCGAAGATCTTTTCATTTACTGAAGCTATACAATCATATTTATGCTTGTTTGTCAAATATAGT AATTTATTGAAAATCAGAAAGAGATGACATCATAAGATGTTTGAAAATTTCAACGTATCACAAAGAGATTCCGTTGATGT TCTGAAGGTTAAATAGATATAGTAAACCTATTTTCATCTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 873329: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8733291858041AA233985MS1MM001.AS6Schistosoma mansoni Lambda Gt11 (Mohamed MM)


Date: 23:1:1 on Wed 22 Nov 117.