EST 880898 is a singleton


Sequence

>880898 (1 EST) Length=103 ATGTTGAATCGCCAAGTACAAGCTTGGCGCACATTATGTAGGTTTACGGGAATAGTTAATAAAAATACGCGAAGCTGTAC GACAAATTTTTCTGATAAGATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 880898: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8808981870882AA241564MBL2SJ0H8T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 9:16:30 on Sat 18 Nov 117.