EST 880904 is a singleton


Sequence

>880904 (1 EST) Length=159 CTGTTTCGTGGTGCAACTGCTTACTGATGGTGACTACGCTGCCAACTTTGTCACCGCTGGCACGGCGACGAATTCACAAC CGGTGAGGCTTGTACAGCTGCACTCAAATGCAAGAGAACAATCGCTCAAGGGAAAGACCGTGAAAGTTAATCCAGCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 880904: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8809041870888AA241596MBL2SJ2A3T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 15:21:7 on Fri 24 Nov 117.