EST 880923 is a singleton


Sequence

>880923 (1 EST) Length=266 TGTTATATAAAGGCAATAAAGATAATATAACGTTAGTTGGCTTTGAAGTTAACTGGAGGAGGAAGGTATCAAACTTGATA GGAAGCTATGTACTGAAAAGTTTCCATGGCAATAGTGGCCTAACCGGCACAACAAAGGAATTTTACTTTTCCCTGTCTCC GTTGAAGGAGCGGGAACTAATTTAAGTAGTTCATCTTCTTTAAAAAAGCATTTTTTTTTCGTGATCTATATTTGAATGTA AATAAAGTTAGATATGCTCTGCGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 880923: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8809231870907AA241615MBL2SJ2B12T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 20:45:9 on Wed 22 Nov 117.